SOME MOLECULAR BIOLOGICAL STUDIES ON
MICRORNA IN RELATION TO PROTEIN AMINO
ACIDS FORMULATION IN BROILERS
Mohamed F. Dowidar1 ; Hamad A. El-Saadawy1 ; Haytham A. A.
Gad1 ; Refaat K. Mohamed2 and Mona M. Al-Shakery2*
1 Department of Biochemistry, Faculty of Veterinary Medicine, Zagazig University,
Zagazig, Egypt, 44511.
2 Department of Biochemistry, Animal Health Research Institute, Zagazig, Egypt,
44516.
Corresponding Author:
Mona Mohamed Al-Shakery Ahmed
Animal Health Research Institute, Zagazig, Egypt (44516)
(+2)01002815925
dr.mona.sarhahmed80@gmail.com
Key Words: MicroRNA, Protein, leucine, Chickens, muscle.
ABSTRACT
Background: MiRNAs, short non-coding, nucleotides that regulate gene
expression through translation repression or degradation of target
mRNAs. Dietary protein has major influence on growth performance and
carcass characteristics. Objectives: This study aimed to evaluate effect of
dietary protein with miRNA on broiler performance and muscle
development. Material and methods: twenty hundred - one day old Ross
chicks are equally allotted into five groups. The first was positive
control; the second was negative control; the 3rd group fed on reduced
protein diet plus leucine (5 gm /kg diet); the 4th fed on reduced protein
diet plus Lysine (1 gm /kg diet) and the 5th fed on reduced protein diet
plus Lysine (1 gm /kg diet) + Leucine (5 gm /kg diet) for 42 days.
Chicken were sacrificed and serum were separated for biochemical
analysis. Muscle tissues were collected for molecular determination.
Results: Chicken fed reduced protein diet plus leucine and lysine showed
highest value of body weight and gain than other. No changes in liver
and kidney functions between groups. Gene expression of miRNA- 449
and mTOR (mammalian target of rapamycin) genes up-regulated in
group fed diet with leucine and lysine followed by group fed leucine.
MiRNA-206 and myostatin down- regulated in group fed diet with
leucine and lysine followed with other groups. Conclusion: MicroRNA
and their target genes have a great influence in muscle development and
growth in chicken fed diet with amino acid leucine and lysine than other
groups.
Egypt. J. of Appl. Sci., 35 (7) 2020 103-114
INTRODUCTION:
MicroRNAs are a class of small non-coding RNAs, 18-25
nucleotides long endogenously generated that regulate the expression of
genes post-transcriptionally by binding to 3'UTR of the target mRNA
through translation inhibition or degradation of mRNA (1). The role of
miRNAs has been detected in many biological processes like
development, cell proliferation, differentiation, apoptosis, immunity,
metabolism and major signaling pathways. MiRNAs have been identified
as diagnostic markers that may be help in monitoring physiological and
pathological processes (2). Hundreds of miRNAs have been identified in
cattle, chickens, pigs and sheep. Studies showed that miRNAs play
critical roles in muscle development and hypertrophy, adipose tissue
growth and early embryonic development (3).
Poultry industry has made numerous progresses with the research
of poultry genetic improvement and feed nutrition. It concerned to
increase the carcass yield and to decrease carcass fat. Increase demands
of consumers to poultry meat has guided the selection toward fastgrowing
strains with a reduced feed conversion ratio, increase body
weight gain, feed efficiency and muscle yield (4). Feed symbolize up to
70 % of the total cost of poultry production and the selection of feed
consumption can reduce feed cost and gas emissions. Feed together with
water provides energy and nutrient necessary for growth, reproduction
and health of the broilers (5). When formulating broiler ration, the main
attention is located on the CP (crude protein) because protein is the most
important component of broiler diets and together with the other main
elements such as carbohydrates, fat, water, vitamins and minerals is
essential for life (6). The balanced protein idea is defined as ideal amino
acid profile to provide broilers with correct minimum levels of essential
and non-essential amino acids. Decreasing balanced protein reduces feed
cost but also reduces performance of bird and profitability (7).
Leucine is one of BCAAs (branched chain amino acids) besides
isoleucine and valine. It has some biological features such as providing
energy, regulating protein, carbohydrate and lipid metabolism, adapting
immunity and mRNA translational origination, so leucine can affect
nutrient metabolism and animal growth (8). Leucine plays a special role
in both adipose tissue and skeletal muscle. It motivates protein synthesis
through the mTOR signaling pathway, mitochondrial biogenesis and fatty
acid oxidation (9).
104 Egypt. J. of Appl. Sci., 35 (7) 2020
The present study was designed to evaluate the role of miRNAs
and their target genes to protein metabolism in broilers and the effects of
amino acid balance of the ration at the molecular levels. Also continue to
provide broiler strains that have improved annual growth, health and
muscle build-up with lower feed intake.
MATERIAL AND METHODS
1-Animals:
Hundred twenty one day old, commercial Ross broiler chicks were
housed in an environmentally, hygienic condition controlled cages and
food added ad libitum for (42 days). On arrival chicks weighted,
vaccinated and randomly separated to five groups with three replicates (8
birds /replicate) in each group and divided as following in table 1:
Group 1: chicks fed on basal standard diets (positive control group).
Group 2: chicks fed on reduced protein diet by1% (negative control
group).
Group 3: chicks fed on reduced protein diet by1% plus leucine (5 gm /kg
diet).
Group 4: chicks fed on reduced protein diet by1% plus Lysine (1 gm /kg
diet).
Group 5: chicks fed on reduced protein diet by1% plus Lysine (1 gm /kg
diet) + Leucine (5 gm /kg diet).
This study was carried out according to the guide lines approved by
the Animal Care and Use Committee, IACUC / 2 /F/58/2020 then one
day after last feeding all birds are scarified and the samples were
collected.
Table 1. Chemical composition of the feed stuffs used in the
experimental diets
Gp (5)
R+Ly+Leu
Gp (4)
R+Lysine
Gp (3)
R+ Leucine
Gp (2)
Reduced (R)
control
Ingredient
Yellow corn 306.32 11.58 11.44 11.58 11.56
Soyabean meal,44% 210 6.92 6.92 6.94 6.82
Fish meal, 68% 5.6 0.2 0.2 0.2 0.2
Soybean oil 13.44 0.4 0.44 0.4 0.44
Calcium Carbonate 7.84 0.28 0.28 0.28 0.28
Calcium dibasic phosphate 8.4 0.3 0.3 0.3 0.3
Common salt 1.68 0.06 0.06 0.06 0.06
premix 4.48 0.16 0.16 0.16 0.16
Lycine Hcl, 78% 1.12 0.06 0.06 0.04 0.04
DL-Methionine, 98% 1.12 0.04 0.04 0.04 0.04
leucine 0 0 0.1 0 0.1
Muvco Premix: Each 3 kg contain vit A (10.000000 IU). vit D3 (2,00000 IU), vit E
(10g), vit k3 (1000 mg), vit B1 (100 mg), vit B2 (5 g), vit B6 (1.5 g), pantothenic acid
(10 g), vit B12 (10 mg), niacin (30 g),folic acid (1000 mg),biotin (50 g), fe (30 g), Mn
(60 g), Cu (4 g), I (300 mg), Co (100 mg) and Zn (50 g)
Egypt. J. of Appl. Sci., 35 (7) 2020 105
2-Additives used:
L- Leucine (Leu) and L-Lysine powder 1000 g, reagent grade,
≥98% (HPLC) were purchased from Sigma-Aldrich (St. Louis, MO,
USA).
METHODS:
a) Blood sampling:
All birds from all groups were scarified at end of experiment and
blood sample were collected, the clean dry tubes, left to clot at room
temperature then centrifuged at 3000 rpm for 5 minute to separate serum
for biochemical analysis of liver function tests ALT and AST (10),
kidney function tests (creatinine and blood urea (11,12)), lipid profile:
TC, TAG, HDL-c, LDL-c and VLDL-c (13), (14), (15), (16) respectively.
b) Tissue sampling:
Immediately after scarifying, small parts of skeletal muscle were
taken, weighed, washed in saline, rapped in aluminum foil and kept in
liquid nitrogen, until be used for determination of gene expression of
miRNA-206, and miRNA-499 and their target genes myostatin and
mTOR. .
Molecular detection:
Total RNA (ribo nucleic acid) was extracted from muscle tissue
using (Invitrogen, ThermoFisher Scientific,) Total RNA extraction kit for
animal tissue according to the manufacture instructions. Total RNA
concentration and purity were assed using the A260/ A280 nm
(nanometer) (absorbance ratio by NanoDrop® ND–1000
Spectrophotometer). Then synthesis of cDNA (complementary
Deoxyribnuclic Acid) performed in a reverse transcription reaction using
TaqManTM Small RNA Assays serves as a template for real time PCR
(Polymerase Chain Reaction) (17). The designed primers for microRNA
and target genes were synthesized by Sangon Biotech (Beijing, China) as
shown in table (2). MiR-206, miR-499, myostatin and mTOR in muscle
tissue by (Thermo Scientific Maxima SYBR Green/ ROX qPCR Master
Mix). The real-time PCR reaction was 95◦C as initial denaturation step
for 15 min followed by 40 cycles of 95◦C denaturation for 20 sec then at
55-60◦C annealing for 30 sec then 72◦C extension for 30 sec. finally use
the absolute or relative quantification (ΔΔCt) methods to analyze results
by method (18).
Table 2: The sequences of PCR primers used to assay gene expression
Sequences Gene of primers
miR-499 UUAAGACUUGUAGUGAUGUUUA
miR-206 TGGAATGTAAGGAAGTGTGTGG
F: CGCTACCCGCTGACAGTGGAT
R: CAGGTGAGTGTGCGGGTATTTCT
myostatin
F:CGGAGGCTGAAGAAGGTGAA
R:CGGTCCTCTGCCTGGTCAT
mTOR
106 Egypt. J. of Appl. Sci., 35 (7) 2020
Statistical analysis:
The acquired data were analyzed statistically and graphically
represented using the PASW Statistics (SPSS version18.0 for Windows)
using one way ANOVA (one-way analysis of variance) to determine the
statistical significance of differences among groups. The comparison of
means was carried out with Duncan’s multiple range tests.
RESULTS
1-Growth performance parameters:
Data concerned the growth performance parameters of broilers
over 42 days feeding period are shown in table (3). FBW (final body
weight), BWG (body weight gain) and PER (protein efficiency ratio) of
chicken were significantly increased (p<0.05) in group 5 (reduced protein
+ leucine and lysine) followed by groups 3 & 4(reduced protein +leucine
or lysine) when compared with control group. In contrast the group 2
(reduced protein diet) showed significant decrease (p<0.05) FBW, BWG
and PER. TFI (total feed intake) and FCR (feed conversion ratio) in
group 2 (reduced protein) recorded highest value while the lowest TFI,
FCR were observed in both control and group 5 (reduced protein +
leucine and lysine).
Table 3: Effects of feeding broiler on reduced protein diet plus
leucine or lysine on the growth performance at42 days
(n=5).
Experimental groups
Gp (1)
Control
Gp (2)
Reduced
Gp
(3)
R+
Leu
Gp
(4)
R+Ly
Gp (5)
R+Ly+Leu
SEM Average
BG (g/bird) 2067c 1903d 2238b 2172b 2496a 1.89 <0.001
TFI (g/bird) 3948bc 4118a 4002b 4010b 3892c 1.48 <0.001
FCR 1.91b 2.16a 1.79c 1.84bc 1.56d 0.02 <0.001
PER 2.45c 2.17d 2.62bc 2.53b 2.99a 0.03 <0.001
2-Blood parameters:
No significant difference in ALT, AST and creatinine values
among different groups but group 5 ( reduced protein + leucine and
lysine) showed a little increase (p<0.05) in urea values when compared
with other groups as shown in table (4).Serum cholesterol, TAG, LDL
and VLDL of group 5( reduced protein + leucine and lysine) had
recorded significant higher (P<0.05) value followed by group 3&5 when
compared to control one, It was found that HDL in group 5 had a highest
increase (P<0.05) value but group 2 had a lowest decrease value.
Egypt. J. of Appl. Sci., 35 (7) 2020 107
Table 4: Some biochemical parameters on experimental broiler at 42
days (n=5).
Experimental groups
Parameters
Gp (1)
Control
Gp (2)
Reduced
(R)
Gp (3)
R+
Leucin
e
Gp (4)
R+Lysi
ne
Gp (5)
R+Ly+Le
u
SEM PVALU
E
ALT(U/l) 37.90 34.35 37.60 35.80 38.55 3.77 0.96
AST (U/l) 33.20 33.80 36.25 32.35 38.75 2.78 0.91
Urea (mg/dl) 14.05c 22.40b 32.75a 26.90ab 28.35ab 8.89 <0.001
Creatinine (mg/dl) 0.59 0.59 0.57 0.59 0.60 0.00 0.98
Cholesterol (mg/dl) 77.50bc 107.00a 79.50b 79.00b 78.80bc 1.50 <0.001
TAG (mg/dl) 87.00d 104.00a 94.50c 96.00b 88.00a 2.08 <0.001
HDL (mg/dl) 50.10b 30.50d 45.00c 43.00c 52.30d 1.22 <0.001
LDL (mg/dl) 10.00c 55.70a 15.60b 16.80b 8.90c 3.14 <0.001
VLDL (mg/dl) 17.40bc 20.80a 18.90b 19.20b 17.60bc 0.08 <0.001
3-Molecular detection:
Gene analysis of mTOR as shown in table (5) were increased
(P<0.05) in group 5 (reduced protein + leucine and lysine) followed by
group 3 &4 (reduced protein +lysine or leucine) when compared with
control group. But myostatin gene analysis was highest increase (P<0.05)
in group 2 (reduced protein) followed by group 3 &4 with comparison
with control group. Gene expression of miRNA-499 was significantly
up-regulated (P<0.05) in groups 3 &4. miRNA- 206 expression was
significantly down-regulated (P<0.05) in groups 3 &4 when compared
with group 2.
Table 5: Effects of feeding broiler chicks on reduced protein diet
supplemented with amino acid on the gene expression of
myostatin, mTOR, miRNA- 499 and miRNA- 206
Control Reduced
diet (R)
R+Leucine R+Lysine R+lys+leu
Myostatin 1.00±0.06e 8.05±0.2a 3.54±0.1b 2.71±0.09c 1.25±0.08d
mTOR 1.00±0.06d 0.7±0.05e 1.10±0.08c 1.87±0.09b 2.82±0.1a
miRNA
499
1.00±0.06d 0.76±0.04e 1.3±0.08c 1.38±0.09b 1.8±0.1a
miRNA
206
1.00±0.06a 0.35±0.04d 0.61±0.05c 0.62±0.05c 0.72±0.05b
DISCUSSION
The present study was designed to evaluate the effect of reduced
dietary protein, supplemented with synthetic amino acids on the
expression of microRNA and their target genes on broiler performance
through some biochemical and molecular analysis for a period of 42
days. Concerning the effect of leucine and lysine supplementation on
broiler performance. These results are in agreement with the findings of
108 Egypt. J. of Appl. Sci., 35 (7) 2020
(19) & (20) on muscle growth compared to diets which contained leucine
or lysine concentrations in low protein diet. The investigation of (21)
agreed with our results that group 2 fed on (reduced protein) resulted
lowering of body weight and a higher feed conversion ratio. Total feed
intake in group 2 recorded the highest value followed by groups 3 &5
(reduced protein + leucine or lysine) while the lowest feed intake was
detected in both control and group 5 (leucine and lysine). Theses results
disagreed with (22) that recorded a significant increase in feed intake
when the protein content of the diet was decreased in spite of amino acid
addition.
Our result revealed no alteration of ALT and AST activities were
recorded which agreed with findings that lowing protein diets did not
elevate AST or ALT (23). Uric acid value was decreased in group 2
compared with other supplemented amino acids groups, this result agreed
with (24) which stated that uric acid was decreased in chicken fed low
protein. TAG, LDL and VLDL-c of groups 2(reduced protein) had a
higher significant increase when compared with group 1 (control). These
results are in agreement with (25).
The present study demonstrated that the growth performance of
broiler in relation to gene expression levels of muscle genes. Group fed
reduced protein diet plus amino acid leucine and or lysine up-regulated
when compared with group 2. Due to its distinctive role, Leucine has a
special care as a nutrient signal to start muscle protein synthesis through
mTOR signaling pathway (26). mTOR through mTOR signaling pathway
has a basic role in modulating growth of muscle fiber and skeletal tissue
development, therefore repressing atrophy in muscles (27) and (28).
Myostatin gene recorded highest value in group 2 (reduced
protein) followed by group 3 (leucine) and group 4 (lysine) but group 5
(leucine and lysine) showed the lowest value. Our study agreed with
previous finding (29) and (30) that showed a negative connection
between myostatin levels and increased muscle mass. Previous studies
reported that myostatin act as inhibitory factor for myogenesis that downregulate
myo-D and is consider one of myogenic factors that play
important roles in muscle growth (31) and (32). The role of myostatin
gene in regulating breast muscle and abdominal fat weight was detected
by (33). (34) Stated that myomiRs are the miRNAs that only expressed in
striated muscle and include miR-206, miR-499 and other. Only specific
microRNA in skeletal muscle was miR-206 but other myomiRs
expressed in both cardicl and skeletal muscles (35).
Egypt. J. of Appl. Sci., 35 (7) 2020 109
Data concerned with expression of microRNA showed that miR-
206 down- regulated in muscle tissue in group 5 &4 reduced protein diet
plus with leucine and or lysine when compared with group 2 (reduced
protein). The recorded data agreed with (36) that miR-206 upgraded
muscle differentiation. These results agreed with the previous research of
(37) that miR-206 expression not always up-regulated as its action is
temporary though it was sufficiently expressed in skeletal muscle tissue.
(38) recorded that miR-206 was highly expressed in broiler resulting in
large muscle mass.
MiR-499 was expressed in cardiac and skeletal muscles, in the
study miR-499 was significantly up-regulated in group 5 (leucine+lysine)
followed by group 3 (leucine) and group 4 (lysine) respectively.
Alternate in miR-499 expression might be included in the adjustment
expression of number genes and signaling transduction pathways (39). It
was revealed that, almost all myomiR family as miR-206 and miR-499
were recorded to be enriched in cardiac or skeletal muscle, performing
different roles in transcription that direct expression of skeletal muscle
gene (40). While, miR-499 showed basic role for slow muscle fiber type
and maintenance in some species as it down- regulate expression of miT-
499 target protein to a suitable level to stop cardiomyocyte apoptosis
(41).
CONCLUSION
In conclusion, the present study showed that the reduction of
protein by 1% in broiler diet formulation with supplementation of
limiting amino acids leucine and lysine in adequate level, greatly
improving the performance of broiler with molecular modulation of
microRNA and their target genes related to protein biosynthesis and
skeletal muscle development.
REFERENCES
1. Amod Kumar ; V.N.Muhasin Asaf ; Kush Srivastava ; Abdul
Rahim ; J.K. Chaudhary and Manjit Panigrahi (2013):
MicroRNA: biogenesis and computational target identification: a
review. Division of Animal Genetics, Indian Veterinary Research
Institute, Izatnagar, India.
2. Karolina, A. ; Chodkowska - Tomasz Sadkowski and Piotr
Ostaszewski. (2017): MicroRNA function in domestic animal
physiology and diseases: a promising diagnostic tool for veterinary
use. Department of Physiological Sciences, Faculty of Veterinary
Medicine, Warsaw University of Life Sciences – SGGW, Poland.
DOI: 10.21521/mw.5654.
110 Egypt. J. of Appl. Sci., 35 (7) 2020
3. Wang, X. ; Z. Gu and H. Jiang (2013): MicroRNAs in farm animals,
Department of Life Science and Technology, China, Animal,
7(10): 1567–1575.
4. Fouad, M. and H.K. El-Senousey (2014): Nutritional factors affecting
abdominal fat deposition in poultry: A review. Department of
Animal Production, Faculty of Agriculture, Cairo University, Giza-
Egypt.
5. Siegel, P.B. (2014): Evolution of the modern broiler and feed efficiency.
Ann. Rev. Anim. Biosci., 2: 375-85.
6. Cheeke, P.R. (2005): Livestock and feeding. 3rd ed. Upper Saddle River,
New Jersey. Pearson Prentice Hall.
7. The poultry site (2015): Indian poultry feed market.
8. Suryawan, A. ; H.V. Nguyen ; R.D. Almonaci and T.A Davis (2012):
Abundance of amino acid transporters involved in mTORC1
activation in skeletal muscle of neonatal pigs is developmentally
regulated. Amino Acids., 45: 523e30.
9. Filhiol, T.M. (2012): The effects of Leucine on mitochondrial biogenesis
and cell cycle in A-375 melanoma cells. In the University of
Tennessee, Knoxville.
10. Breuer, J. (1996): Report on the symposium "drug effects in clinical
chemistry methods". Eur J Clin Chem clin Biochem., 34: 385-386.
11. Bowers, L.D. and E.T. Wong (1980): Kinetic serum creatinine assays.
II. A critical evaluation and review. Clin Chem., 26: 555.
12. Batton, C.J. and S.R. Crouch (1977): Spectrophotometric and kinetics
investigation of the Berthelot reaction for the determination of
ammonia. Anal.Chem, (49): 464-469.
13. Ellefson, R.D. and W.T. Caraway (1976): Fundamentals of clinical
chemistry. Ed Titez NW; p 506.
14. Bucolo, G. and H. David (1973): Quantitative determination of serum
triglycerides by the use of enzymes. Clin Chem (19): 475.
15. Sugiura, M. ; T. Oikawa ; K. Hirano ; H. Maeda ; H. Yoshimura
; M. Sugiyama and T. Kuratsu (1977): A Simple
colorimetric method for determination of serum triglycerides
with lipoprotein lipase and glycerol dehydrogenase. Clinica
Chimica Acta, 81: 125-130.
16. Friedewald, W.T. ; R.I. Levy and D.S. Fredrickson (1972):
Estimation of the Concentration of Low-Density Lipoprotein
Cholesterol in Plasma without use of the preparative
ultracentrifuge. Clinical Chemistry, 18: 6.
17. Chen, C. ; D.A. Ridzon ; A.J. Broomer ; Z. Zhou ; D.H. Lee ; J.T.
Nguyen ; M. Barbisin ; N.L. Xu ; V.R. Mahuvakar ; M.R.
Andersen ; K.Q. Lao ; K.J. Livak and K.J. Guegler (2005):
Egypt. J. of Appl. Sci., 35 (7) 2020 111
Real-time quantification of microRNAs by stem-loop RT-PCR.
Nucleic Acids Res., 33: e179.
18. Livak, K.J. and T.D. Schmittgen (2001): Analysis of relative gene
expression data using real-time quantitative PCR and the2–ΔΔCT
method. Methods., 25: 402-408.
19. Atherton, P. J. ; K. Smith ; T. Etheridge ; D. Rankin and M.J.
Rennie (2010): Distinct anabolic signalling responses to amino
acids in C2C12 skeletal muscle cells. Amino Acids., 38: 1533-
1539.
20. Tesseraud, S. ; K. Bigot and M. Taouis (2003): Amino acid
availability regulates S6K1 and protein synthesis in avian insulininsensitive
QM7 myoblasts. FEBS Letters., 540: 176-180.
21. Kidd, M.T. ; P.D. Gerard ; J. Heger ; B.J. Kerr ; D. Rowe ; K.D.
Sistani and J. Burnham (2001): Threonine and crude protein
responses in broiler chicks. Anim. Feed Sci. Technol., 94: 57-64.
22. Cheng, T.K. ; M.L. Hamre and C.N. Coon (1997): Effect of
environmental temperature, dietary protein, and energy levels on
broiler performance. J. Appl. Poult. Res., 6: 1-17.
23. Rozenboim, I. ; J. Mahato ; N.A. Cohen and O. Tirosh (2016): Low
protein and high-energy diet: a possible natural cause of fatty liver
hemorrhagic syndrome in caged White Leghorn laying hens. Poult
Sci., 95 (3): 612-21.
24. Malheiros, R.D. ; V.M.B. Moraes ; A. Collin ; G.P.J. Janssens ; E.
Decuypere and J. Buyse (2003): Dietary macronutrients,
endocrine functioning and intermediary metabolism in broiler
chickens. Pair wise substitutions between protein, fat and
carbohydrate. Nutr. Res., 23: 567-578.
25. Swennen, Q. ; G.P.J. Janssens ; A. Collin ; E.L. Bihan-Duval ; K.
Verbeke ; E. Decuypere and J. Buyse (2006): Diet-induced
thermogenesis and glucose oxidation in broiler chickens: Influence
of genotype and diet composition. Poult. Sci., 85: 731-742.
26. Wullschleger, S. R. and M.N. Loewith (2006): Hall, mTOR signaling
in growth and metabolism. Cell, 124 (3): 471-484.
27. Bodine, S.C. ; T.N. Stitt ; M. Gonzalez ; W.O. Kline ; G.L. Stover ;
R. Bauerlein ; E. Zlot-Chenko ; A. Scrimgeour ; J.C.
Lawrence ; D.J. Glass and G.D. Yancopoulos (2001): Akt/
mTOR pathway is a crucial regulator of skeletal muscle
hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell
Biol, 3: 1014-1019.
28. Hunter, R.B. and S.C. Kandarian (2004): Disruption of either the
Nfkb1 or the Bcl3 gene inhibits skeletal muscle atrophy. J. Clin.
Invest., 114: 1504–1511.
112 Egypt. J. of Appl. Sci., 35 (7) 2020
29. Grobet, L. ; L.J. Martin ; D. Poncelet ; D. Pirottin ; B. Brouwers
; J. Riquet ; A. Schoeberlein ; S. Dunner ; F. Menissier
and J. Massabanda ( 1997): A deletion in the bovine
myostatin gene causes the double-muscled phenotype in cattle.
Nat Gen., 17: 71-74.
30. Lee, S.J. (2004): Regulation of muscle mass by myostatin. Ann Rev
Cell Develop Biol., 20: 61–86.
31. Joulia, D. ; H. Bernardi ; V. Garandel ; F. Rabenoelina ; B Vernus
and G. Cabello (2003): Mechanisms involved in the inhibition of
myoblast proliferation and differentiation by Myostatin. Exper Cell
Res., 286: 263-275.
32. Te Pas, M.F.W. and A. Soumillion (2001): Improvement of livestock
breeding strategies using physiologic and functional genomics
information of the muscle regulatory factors gene family for
skeletal muscle development. Curr Gen., 2: 285-304.
33. Gu, Z. (2004). The single nucleotide polymorphisms of the chicken
myostatin gene are associated with skeletal muscle and adipose
growth. Sci. China Ser. C 47, 25.
34.Mccarthy, J.J. (2008). MicroRNA-206: The skeletal muscle-specific
myomiR. Biochim. Biophys. Acta - Gene Regul. Mech, 1779:
682–691.
35. Lagos-Quintana, M. ; R. Rauhut ; A. Yalcin ; J. Mwywe ; W.
Lendeckel and T. Tuschl (2002): Identification of tissue-specific
MicroRNAs from mouse. Curr. Biol., 12: 735-739.
36. Chen, J.F. ; E.M. Mandel ; J.M. Thomson ; Q. Wu ; T.E. Callis ;
S.M. Hammond ; F.L. Conlon and D.Z. Wang (2006): The role
of microRNA-1 and microRNA-133 in skeletal muscle
proliferation and differentiation. Nat. Genet., 38: 228-233.
37. Hakk, K. ; S.L. Yong ; U. Sivaprasad ; A. Malhotra and A. Dutta
(2006): Muscle-specific microRNA miR-206 promotes muscle
differentiation. J. Cell Biol., 174: 677-687.
38. Ledur, M.C. ; E.L. Zanella; G.S. Schmidt and F.R.F. Jaenisch
(2010): Divergence of Strains and Strain Crosses used to Develop
New Reference Populations for QTL Studies in Poultry. Abstracts
of 21st World’s Poultry Congress, Montreal.
39. Wei, W. ; Z. Hu ; H. Fu ; Y. Tie ; H. Zhang ; Y. Wu and X. Zheng
(2012): MicroRNA-1 and microRNA-499 downregulate the
expression of the ets1 proto-oncogene in HepG2 cells. Oncol Rep.,
28: 701-706.
40. Gagan, J. ; B.K. Dey and A. Dutta (2012): MicroRNAs regulate and
provide robustness to the myogenic transcriptional network. Cur
Op in Phar., 12: 1–6.
Egypt. J. of Appl. Sci., 35 (7) 2020 113
41. Bhuiyan, S.S. ; S. Kinoshita ; C. Wongwarangkana ; M.
Asaduzzaman ; S. Asakawa and S. Watabe (2013): Evolution of
the myosin heavy chain gene MYH14 and its intronic microRNA
miR-499: muscle-specific miR-499 expression persists in the
absence of the ancestral host gene. BMC Evol Biol., 13: 142.
بعض الد ا رسات البیول وجیة الجزیئیة عمی الحمض النووی الربیوزی المیکرو
و علاقتها بترکیبة الاحماض الامینیة لمبروتین فی دجاج التسمین
محمد فهمی دویدار 1، حمد أمین السعداوی 1 ، هیثم عبدالله عمی جاد 1 ، رفعت خضری محمد
2 و منى محمد الشاکری احمد 2
1 قسم الکیمیاء الحیویة - کمیة الطب البیطری-جامعة الزقازیق- مصر
2 قسم الکیمیاء الحیویة – معید بحوث الصحة الحیوانیة – الزقازیق – مصر
22 قواعد نیتروجینیة تنظم التعبیر - االاحماض النوویة الربیوزیة الدقیقة تتکون من 11
الجینی من خلال قمع الترجمة أو وقف الحمض النووی الرسول المستیدف. البروتین الغذائی لو
تأثیر کبیر عمى أداء النمو وخصائص الذبیحة. الأىداف: ىدفت ىذه الد ا رسة إلى تقییم تأثیر
البروتین الغذائی الحمض النووی الریبوزی الدقیق عمى أداء دجاج التسمین ونمو العضلات.
المواد والأسالیب: یتم توزیع مائة کتکوت روس یبمغ من العمر یوم بالتساوی فی خمس
مجموعات. الأول کان السیطرة الإیجابیة. والثانی ىو السیطرة السمبیة. المجموعة الثالثة تغذت
عمى نظام غذائی منخفض البروتین بالإضافة إلى المیوسین ) 2 جم / کجم عمف( ؛ تم تغذیتو
ال ا ربعة عمى نظام غذائی منخفض البروتین بالإضافة إلى لیسین ) 1 جم / کجم عمف( والخامس
عمى نظام غذائی منخفض البروتین بالإضافة إلى لیسین ) 1 جم / کجم عمف( + لیوسین ) 2
جم / کجم عمف( لمدة 22 یومًا. تم ذبح الدجاج وفصل المصل لمتحمیل الکیمیائی الحیوی. تم
جمع أنسجة العضلات لتحدید الجزیئات. النتائج: الدجاج الذی تم تغذیتو عمى نظام غذائی
منخفض البروتین بالإضافة إلى المیسین لیوسین أظی رت أعمى قیمة لوزن الجسم وزیادة عن
غیره. لا توجد تغیی ا رت فی وظائف الکبد والکمى بین المجموعات. التعبیر الجینی عن جینات
التی تم تنظیمیا فی نظام غذائی جماعی مع المیسین و لیوسین mTOR وmiRNA- 449
أظی رت اقل قیمة myostatin و. MiRNA- متبوعًا لیوسین بینما المجموعة التی تتغذى 206
لمتعبیر الجینی عن غیره فی المجموعة التی تتغذی عمی لیسین و لیوسین متبوعًا بمجموعات
أخرى. الخلاصة: إن الحمض النووی الریبوزی الدقیق والجینات المستیدفة لیا تأثیر کبیر فی
نمو العضلات ونموىا فی الدجاج الذی یتغذى عمى الأحماض الأمینیة لیسین و لیوسین أکثر
من المجموعات الأخرى.
114 Egypt. J. of Appl. Sci., 35 (7) 2020
